Construct:Article Title: Drebrin controls scar formation and astrocyte reactivity upon traumatic brain injury by regulating membrane trafficking
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz; Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAAGCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGTTCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn −/− astrocytes in conjunction with pCDF-mRuby-RAB8A . pEYFP-N1 (Takara Bio Inc) was used as a corresponding negative control. pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Article Title: Drebrin controls scar formation and astrocyte reactivity upon traumatic brain injury by regulating membrane trafficking.
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz;73 Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAA GCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGT TCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn−/− astrocytes in conjunction with pCDF-mRuby-RAB8A74. pEYFP-N1 (Takara Bio Inc) was used as a corresponding negative control. pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Article Title: Drebrin mediates scar formation and astrocyte reactivity during brain injury by inducing RAB8 tubular endosomes
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz, ( ); Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAAGCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGTTCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn −/− astrocytes in conjunction with pCDF-mRuby-RAB8A ( ). pEYFP-N1 (Takara Bio Inc) was used as corresponding negative control.pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Plasmid Preparation:Article Title: Drebrin controls scar formation and astrocyte reactivity upon traumatic brain injury by regulating membrane trafficking
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz; Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAAGCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGTTCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn −/− astrocytes in conjunction with pCDF-mRuby-RAB8A . pEYFP-N1 (Takara Bio Inc) was used as a corresponding negative control. pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Article Title: Drebrin controls scar formation and astrocyte reactivity upon traumatic brain injury by regulating membrane trafficking.
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz;73 Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAA GCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGT TCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn−/− astrocytes in conjunction with pCDF-mRuby-RAB8A74. pEYFP-N1 (Takara Bio Inc) was used as a corresponding negative control. pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Article Title: Drebrin mediates scar formation and astrocyte reactivity during brain injury by inducing RAB8 tubular endosomes
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz, ( ); Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAAGCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGTTCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn −/− astrocytes in conjunction with pCDF-mRuby-RAB8A ( ). pEYFP-N1 (Takara Bio Inc) was used as corresponding negative control.pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Mutagenesis:Article Title: Drebrin controls scar formation and astrocyte reactivity upon traumatic brain injury by regulating membrane trafficking
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz; Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAAGCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGTTCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn −/− astrocytes in conjunction with pCDF-mRuby-RAB8A . pEYFP-N1 (Takara Bio Inc) was used as a corresponding negative control. pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Article Title: Drebrin controls scar formation and astrocyte reactivity upon traumatic brain injury by regulating membrane trafficking.
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz;73 Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAA GCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGT TCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn−/− astrocytes in conjunction with pCDF-mRuby-RAB8A74. pEYFP-N1 (Takara Bio Inc) was used as a corresponding negative control. pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Article Title: Drebrin mediates scar formation and astrocyte reactivity during brain injury by inducing RAB8 tubular endosomes
Article Snippet: .. The lentiviral construct pCDF-paxillin-EGFP was subcloned from pEGFP-N3-paxillin (gift from Rick Horwitz, ( ); Addgene plasmid #15233) into pCDF-GFAP:Lifeact-GFP via NheI/BsRGI after silent mutation of an internal BsRGI site (Paxillin-BsrGImut-s: GAGGAGGAACACGTGTATAGCTTCCCAAACAAGCAG; Paxillin-BsRGImut-as: CTGCTTGTTTGGGAAGCTATACACGTGTTCCTCCTC). .. Previously published pEYFP-N1-DBN E was co-transfected in rescue experiments in Dbn −/− astrocytes in conjunction with pCDF-mRuby-RAB8A ( ). pEYFP-N1 (Takara Bio Inc) was used as corresponding negative control.pDEST15-hSlp4-a was purchased from Addgene (Plasmid#40046).
Polymerase Chain Reaction:Article Title: The Chlamydia Effector TarP Mimics the Mammalian Leucine-Aspartic Acid Motif of Paxillin to Subvert the Focal Adhesion Kinase during Invasion
Article Snippet: .. The LD (LEHLLPQL; Ser640–Pro740), mutLD (AEHAAPQI; Ser640–Pro740), and GPIC714 – 880 fragments were PCR-amplified from C. caviae GPIC TarP clone (36) and paxillin LD2 (LDRLLLEL; Lys125– Glu186) from pEGFP-N3-paxillin (Ref. 37; obtained from Prof. Rick Horwitz (University of Virginia) through Addgene) using primer pairs 3– 4, 5– 6, 7– 8, and 15–16, respectively. ..
|
Addgene inc is a verified supplier 